| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.224949 |
| Chromosome: | chromosome 13 |
| Location: | 2666404 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g581801 | (1 of 1) PTHR13198//PTHR13198:SF4 - RING FINGER PROTEIN 25 // E3 UBIQUITIN-PROTEIN LIGASE RNF25 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTATTCAACAGGGGGAAGGCCAGGCAGGT |
| Internal bar code: | CATTTAGTTTGGTATGGAAGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 265 |
| LEAP-Seq percent confirming: | 98.6379 |
| LEAP-Seq n confirming: | 2607 |
| LEAP-Seq n nonconfirming: | 36 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGGTTGCGTGTAGGAGATG |
| Suggested primer 2: | AGTAGCTCGCCTGCTCAATC |