Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.224962 |
Chromosome: | chromosome 9 |
Location: | 5129730 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g398845 | (1 of 1) PF08507 - COPI associated protein (COPI_assoc) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCCATCATCAACCATAGTCACGGACCCCG |
Internal bar code: | AGCCTTTAAGAGCCCGCCTCGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 419 |
LEAP-Seq percent confirming: | 89.8551 |
LEAP-Seq n confirming: | 124 |
LEAP-Seq n nonconfirming: | 14 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCGTCAGAGCAAACTGGAT |
Suggested primer 2: | GCTCTTTTACGCCTCGTGTC |