| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.224966 |
| Chromosome: | chromosome 12 |
| Location: | 4190797 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g518550 | FAP54,C1d-HC1 | Flagellar central pair-associated protein 54; (1 of 1) PF14858 - Domain of unknown function (DUF4486) (DUF4486) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCACCTCAATCACCTGAGAAAGAGGTGGT |
| Internal bar code: | TCCAACCGCAACTAACAGGATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 548 |
| LEAP-Seq percent confirming: | 91.224 |
| LEAP-Seq n confirming: | 395 |
| LEAP-Seq n nonconfirming: | 38 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCGTGGTGTACGTAGCGTG |
| Suggested primer 2: | GTAACGAGGTTGGTGTGCCT |