Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.225437 |
Chromosome: | chromosome 6 |
Location: | 65489 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g249350 | DMC3,DMT1A | (1 of 4) K00558 - DNA (cytosine-5)-methyltransferase 1 (DNMT1, dcm); Putative DNA methylase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCTGTGGAGTTTGACGCCAACGCCGCCA |
Internal bar code: | ACCCGCAATTAAGACAATACCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 536 |
LEAP-Seq percent confirming: | 92.4706 |
LEAP-Seq n confirming: | 1572 |
LEAP-Seq n nonconfirming: | 128 |
LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACAGTTGGCCTGATTCGTA |
Suggested primer 2: | GTTATTCTCCTCTGCCGCTG |