| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.225437 |
| Chromosome: | chromosome 8 |
| Location: | 3904611 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g378200 | PPO1 | (1 of 1) 5.1.99.6 - NAD(P)H-hydrate epimerase / NAD(P)HX epimerase; Pyridoxamine 5'-phosphate oxidase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTAGCTCAATGTTGTTTATTGCCGGCTCG |
| Internal bar code: | CAACTCGCTATAGCAGGCAAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 293 |
| LEAP-Seq percent confirming: | 99.3056 |
| LEAP-Seq n confirming: | 12871 |
| LEAP-Seq n nonconfirming: | 90 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTCATTCCCTCTCCCTCTC |
| Suggested primer 2: | TACCCAAGCTACATACGCCC |