| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.225461 |
| Chromosome: | chromosome 16 |
| Location: | 1712774 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g654800 | CPC2 | Central pair microtubule complex 2; (1 of 1) PTHR24198//PTHR24198:SF25 - ANKYRIN REPEAT AND PROTEIN KINASE DOMAIN-CONTAINING PROTEIN // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCGGGCGGGCAAGGGTGCACCCCGCATG |
| Internal bar code: | CTCCTGTCATTAATATGTTAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 310 |
| LEAP-Seq percent confirming: | 98.4728 |
| LEAP-Seq n confirming: | 2837 |
| LEAP-Seq n nonconfirming: | 44 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACGTTTGAGGCTGCTGTTT |
| Suggested primer 2: | CCTGTTGCTGCTTCGTGATA |