Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.225498 |
Chromosome: | chromosome 17 |
Location: | 2339152 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g714450 | KUP3 | (1 of 5) K03549 - KUP system potassium uptake protein (kup); Potassium ion uptake transporter | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCATCCGCCCCCACGACGTCATGTTTCG |
Internal bar code: | AGGGACGCGGAATTACGGGATG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 266 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 89 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATGCGAACAATTCCGTTAGG |
Suggested primer 2: | GTCAGTCGCCTCCTTGAGAC |