Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.225509 |
Chromosome: | chromosome 16 |
Location: | 6101397 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g675850 | (1 of 1) K11729 - acyl-CoA dehydrogenase family member 10 (ACAD10) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAATCCTTGCAACCCACCAGCCCTCCCAC |
Internal bar code: | CAGGTCGCGATACGGTGGATCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 114 |
LEAP-Seq percent confirming: | 59.4156 |
LEAP-Seq n confirming: | 183 |
LEAP-Seq n nonconfirming: | 125 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCTGCTACTGCTGCTACTG |
Suggested primer 2: | CGTGTGCCTGCTCTGTGTAT |