| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.225527 |
| Chromosome: | chromosome 10 |
| Location: | 1203658 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g426292 | PYK6 | (1 of 3) PTHR11817//PTHR11817:SF4 - PYRUVATE KINASE // PYRUVATE KINASE; Pyruvate kinase 6 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGTTGGGCTGGCGATAGTGAGAGGTAAT |
| Internal bar code: | CGCCTTGTATCACGCGAGTGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 281 |
| LEAP-Seq percent confirming: | 66.2295 |
| LEAP-Seq n confirming: | 202 |
| LEAP-Seq n nonconfirming: | 103 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCGTGTACTTAGGGATGGA |
| Suggested primer 2: | GATGCCAGTATGCCACACAC |