| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.225550 |
| Chromosome: | chromosome 2 |
| Location: | 500205 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g076900 | FAP19,CrPKG,CGK2 | (1 of 1) PTHR24353:SF32 - PROTEIN PKG-2, ISOFORM C; Flagellar Associated Protein 19 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACGTCCACTTCTGTCCGGTGGTACCTGCC |
| Internal bar code: | TAGCGAAACCGATAGCTTATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 856 |
| LEAP-Seq percent confirming: | 99.2322 |
| LEAP-Seq n confirming: | 3231 |
| LEAP-Seq n nonconfirming: | 25 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTTGTGGGACTGGATCGAC |
| Suggested primer 2: | GAGAAGGAGCACGCTACCAC |