| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.225637 |
| Chromosome: | chromosome 16 |
| Location: | 2714780 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g662450 | DeSI-4,DESI4 | (1 of 2) PTHR12378:SF7 - DESUMOYLATING ISOPEPTIDASE 1; DeSI-type SUMO protease | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTGCTACGACCAAGATACGTAAATCAAGG |
| Internal bar code: | TATAAAATGCAGACTGTCCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 111 |
| LEAP-Seq percent confirming: | 98.8095 |
| LEAP-Seq n confirming: | 166 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCATGCCCTGATACACACAC |
| Suggested primer 2: | GGCTGGCAGTAGCAGTTCA |