| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.225722 |
| Chromosome: | chromosome 7 |
| Location: | 4260229 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g341850 | TIF2,INFB,IF2,EIF2,CIF2 | Chloroplast translation initiation factor 2; (1 of 1) PTHR23115//PTHR23115:SF138 - TRANSLATION FACTOR // TRANSLATION INITIATION FACTOR IF-2, CHLOROPLASTIC | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCACCATCCTTCCGCCCCCACACTGATCT |
| Internal bar code: | AGTAAACAGCATGTCGCGGACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 326 |
| LEAP-Seq percent confirming: | 99.654 |
| LEAP-Seq n confirming: | 288 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACTTTGGTGCACTCTGCAA |
| Suggested primer 2: | AAGCTGACCAAGAGCGGATA |