| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.225864 |
| Chromosome: | chromosome 12 |
| Location: | 2295533 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g507750 | (1 of 1) PF00069//PF07714//PF13637 - Protein kinase domain (Pkinase) // Protein tyrosine kinase (Pkinase_Tyr) // Ankyrin repeats (many copies) (Ank_4) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCTCCCTTTCCCCAAACCCGCCAGGTCCT |
| Internal bar code: | GACCGAAGCCCAAAAACCGCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 525 |
| LEAP-Seq percent confirming: | 83.7246 |
| LEAP-Seq n confirming: | 535 |
| LEAP-Seq n nonconfirming: | 104 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGGACGTGTTCAAGGGTTT |
| Suggested primer 2: | ATGGGGTCCATGTTCCAGTA |