| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.225922 |
| Chromosome: | chromosome 16 |
| Location: | 4089962 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g669550 | METC,METC1 | Cystathionine beta-lyase; (1 of 1) 4.4.1.8 - Cystathionine beta-lyase / Cystine lyase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCATTGACGTTGACCAGCGGCCGCTCGCTC |
| Internal bar code: | AGAGACTAGTGATGTCATAGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 960 |
| LEAP-Seq percent confirming: | 99.7447 |
| LEAP-Seq n confirming: | 15235 |
| LEAP-Seq n nonconfirming: | 39 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATGATGGTTGGTTCCTGCT |
| Suggested primer 2: | GGCGAGGGTAATACCTGTCA |