| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.226009 |
| Chromosome: | chromosome 7 |
| Location: | 2381288 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g328500 | ARS17 | Arylsulfatase; (1 of 19) 3.1.6.1 - Arylsulfatase / Sulfatase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCCTGAACGAGTTCACGCCCGCCGGCGC |
| Internal bar code: | TACCACGCCGCATCGAAACCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 229 |
| LEAP-Seq percent confirming: | 95.3488 |
| LEAP-Seq n confirming: | 287 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGATGGAGTGAAGGGAGAG |
| Suggested primer 2: | TCCACACACTTACCCGTTCA |