| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.226070 |
| Chromosome: | chromosome 2 |
| Location: | 6714275 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g118050 | CYCU1 | U-type cyclin; (1 of 1) PTHR15615:SF20 - CYCLIN FAMILY PROTEIN-RELATED | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGCATCTACCGGGATGAAGAGGACGAGGA |
| Internal bar code: | TTTATAGTCTAGTTAGTTTCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1069 |
| LEAP-Seq percent confirming: | 97.7951 |
| LEAP-Seq n confirming: | 10911 |
| LEAP-Seq n nonconfirming: | 246 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTACCATAGCGTCCGACCAT |
| Suggested primer 2: | TCGTTATGGCCCTGGTCTAC |