Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.226070 |
Chromosome: | chromosome 16 |
Location: | 1016856 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g649100 | MAPKKK13 | (1 of 1) K04419 - mitogen-activated protein kinase kinase kinase 11 (MAP3K11, MLK3); Mitogen-Activated Protein Kinase Kinase Kinase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGCTTCCGGTGGTGCCCTCCGACTTCCTG |
Internal bar code: | CTGTCGTGTTGTGAAGGCCCCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 623 |
LEAP-Seq percent confirming: | 98.6347 |
LEAP-Seq n confirming: | 4768 |
LEAP-Seq n nonconfirming: | 66 |
LEAP-Seq n unique pos: | 82 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTAAAACATTTGCGGCGAT |
Suggested primer 2: | TGTACTGGACCCCAAAAAGC |