Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.226071 |
Chromosome: | chromosome 17 |
Location: | 1089460 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g703900 | IFT172,SLB | (1 of 1) PTHR15722:SF2 - INTRAFLAGELLAR TRANSPORT PROTEIN 172 HOMOLOG; Intraflagellar Transport Protein 172 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATTGCCCCAGCTACCCGCCCAACCTAAGG |
Internal bar code: | TGGCCCCTATAAGCACATTGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 556 |
LEAP-Seq percent confirming: | 99.0491 |
LEAP-Seq n confirming: | 625 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGAACTACTACCTGGCCGC |
Suggested primer 2: | CCGCTCTACGGTGCTTCTAC |