Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.226092 |
Chromosome: | chromosome 11 |
Location: | 2893269 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g477850 | TXC1,TSN1 | (1 of 1) K15979 - staphylococcal nuclease domain-containing protein 1 (SND1); Transcriptional coactivator-like protein | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAAGCGGGGCCTGGGTGGATTGTTTTCAT |
Internal bar code: | GGAGTCAAGGGTCGGCAATAGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 562 |
LEAP-Seq percent confirming: | 94.4075 |
LEAP-Seq n confirming: | 709 |
LEAP-Seq n nonconfirming: | 42 |
LEAP-Seq n unique pos: | 46 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCAGCCCAAACTTAGACCAA |
Suggested primer 2: | CAAGCAGGCAGGACTGTGTA |