| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.226121 |
| Chromosome: | chromosome 2 |
| Location: | 6296023 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g114700 | CYN17,RSP12 | (1 of 1) PTHR11071//PTHR11071:SF193 - PEPTIDYL-PROLYL CIS-TRANS ISOMERASE // PEPTIDYL-PROLYL CIS-TRANS ISOMERASE-LIKE 6; Radial spoke protein 12 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAGGAAAGGCGGCACAGCGAAGGTGCCCG |
| Internal bar code: | TTCCCTGCCACATAGCCTTAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 951 |
| LEAP-Seq percent confirming: | 92.3445 |
| LEAP-Seq n confirming: | 193 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCGGTAAACTTTGGATGCC |
| Suggested primer 2: | TGTACCACGACTGGTTTCCA |