| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.226161 |
| Chromosome: | chromosome 12 |
| Location: | 1777912 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g512250 | RRP6b,RRP7 | 3'-5' endonuclease; (1 of 1) K12591 - exosome complex exonuclease RRP6 (RRP6, EXOSC10) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAAGTTGCTATACACATCAAAACAATATAG |
| Internal bar code: | GGGAGCTATGTTCGATGGACGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 386 |
| LEAP-Seq percent confirming: | 99.3289 |
| LEAP-Seq n confirming: | 296 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGTGGAACTTTTCAGAAGC |
| Suggested primer 2: | GCCTAGAGGCTGACTTCCCT |