Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.226169 |
Chromosome: | chromosome 10 |
Location: | 456152 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g420900 | HEL44 | (1 of 1) K13181 - ATP-dependent RNA helicase DDX27 [EC:3.6.4.13] (DDX27, DRS1); DEAD/DEAH box helicase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGAGAGGCTTAAGGAGGCTACGGGGACC |
Internal bar code: | TGGTCTTGACCGGGTGGATCGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 591 |
LEAP-Seq percent confirming: | 98.9796 |
LEAP-Seq n confirming: | 873 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TAGCTCCGACAACCTCGTCT |
Suggested primer 2: | GCAAGTAAAGCCAGGACAGC |