| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.226185 |
| Chromosome: | chromosome 10 |
| Location: | 1272594 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g427000 | MOC2 | (1 of 2) K15032 - mTERF domain-containing protein, mitochondrial (MTERFD); putative mTERF domain containing protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAACTCAAACCCGCCCGTGCTGTTGCCGCT |
| Internal bar code: | CCGAAGCGACGCGATCTCATTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 502 |
| LEAP-Seq percent confirming: | 97.7125 |
| LEAP-Seq n confirming: | 5724 |
| LEAP-Seq n nonconfirming: | 134 |
| LEAP-Seq n unique pos: | 55 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTTTTTGAGTTCAGCCTGG |
| Suggested primer 2: | ACCCGTACCGTCATCACATT |