| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.226239 |
| Chromosome: | chromosome 14 |
| Location: | 1850313 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g620350 | GCH3 | (1 of 1) K14652 - 3,4-dihydroxy 2-butanone 4-phosphate synthase / GTP cyclohydrolase II (ribBA); Putative GTP cyclohydrolase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAATGCAGTCTATCACAAGGACCGCACGCA |
| Internal bar code: | TGACACGAGCATGGCGGTGGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 597 |
| LEAP-Seq percent confirming: | 99.2793 |
| LEAP-Seq n confirming: | 551 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGCCAAGCAACACCTATCA |
| Suggested primer 2: | TTGAGAGGACAAGCAACGTG |