| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.226245 |
| Chromosome: | chromosome 10 |
| Location: | 2141903 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g433550 | DNL4,LIG4,LIG2 | (1 of 21) IPR001357 - BRCT domain; DNA ligase 4 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGACAACGGCCCATTGGCATCAAGGGCT |
| Internal bar code: | TCGCAGTCGAACGGACGCAGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 340 |
| LEAP-Seq percent confirming: | 98.6918 |
| LEAP-Seq n confirming: | 7544 |
| LEAP-Seq n nonconfirming: | 100 |
| LEAP-Seq n unique pos: | 64 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCATACTATCACTGCCGCC |
| Suggested primer 2: | TAAATGGACGCTGGGTAAGC |