Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.226269 |
Chromosome: | chromosome 3 |
Location: | 4499808 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g176300 | (1 of 1) IPR027420 - DNA polymerase beta, N-terminal domain | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCTGCGCCAGCCTCCCAGCTCCCTCCCC |
Internal bar code: | AGCGGGGCTCCGGACACTCTGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 361 |
LEAP-Seq percent confirming: | 99.681 |
LEAP-Seq n confirming: | 14999 |
LEAP-Seq n nonconfirming: | 48 |
LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCCCAACCAGATGGTATGAC |
Suggested primer 2: | GACTCAGGAGGTGGTTCGAG |