| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.226348 |
| Chromosome: | chromosome 12 |
| Location: | 2524643 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g506000 | IC69,ODA6,ODA-IC2,DIC2,IC70,IC2 | (1 of 1) K11143 - dynein intermediate chain 2, axonemal (DNAI2); Flagellar Outer Arm Dynein Intermediate Chain 2 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTACACGGAAGCGGAGCACACGATCCGGTA |
| Internal bar code: | TTTTTTCAGGCACTGCACTCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 548 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 36 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCCCTTCCCCCTTATCCTT |
| Suggested primer 2: | CGTGTTTATTGCACCGAATG |