| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.226393 |
| Chromosome: | chromosome 8 |
| Location: | 4587271 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g383101 | FAP324 | (1 of 1) PF00041//PF13418 - Fibronectin type III domain (fn3) // Galactose oxidase, central domain (Kelch_4); Flagellar Associated Protein 324 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCATAACTCCATTCCAACCCCAAGTCCT |
| Internal bar code: | CGGATCGGAGGTATGCCTGGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 562 |
| LEAP-Seq percent confirming: | 99.4615 |
| LEAP-Seq n confirming: | 6649 |
| LEAP-Seq n nonconfirming: | 36 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCAAGTTCGGTTACATCGT |
| Suggested primer 2: | CGACCAATCAACCCGTCTAT |