Insertion junction: LMJ.RY0402.226400_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.226400
Chromosome:chromosome_10
Location:1637890
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre10.g429750 antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):GGATGATGGTTGTGGTGGCGGGTTCATGCT
Internal bar code:ACTACGACATTCGATGGCCCGA

Confirmation - LEAP-Seq

LEAP-Seq distance:624
LEAP-Seq percent confirming:98.6592
LEAP-Seq n confirming:1766
LEAP-Seq n nonconfirming:24
LEAP-Seq n unique pos:43

Suggested primers for confirmation by PCR

Suggested primer 1:ACTGCCCACTCTGGCTTCTA
Suggested primer 2:CTCCAGATCCAGACGTCCAT