Insertion junction: LMJ.RY0402.226400_2

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:-
Strain:LMJ.RY0402.226400
Chromosome:chromosome_10
Location:1637896
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre10.g429750 antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):ACTCTTTAGTCCTGACCTTCCACTCCTCCA
Internal bar code:GGCATCTAGTTTGATATTAACG

Confirmation - LEAP-Seq

LEAP-Seq distance:891
LEAP-Seq percent confirming:99.661
LEAP-Seq n confirming:11172
LEAP-Seq n nonconfirming:38
LEAP-Seq n unique pos:6

Suggested primers for confirmation by PCR

Suggested primer 1:ACTGCCCACTCTGGCTTCTA
Suggested primer 2:CTCCAGATCCAGACGTCCAT