| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.226411 |
| Chromosome: | chromosome 9 |
| Location: | 6577165 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g408250 | EEF1A2 | Eukaryotic translation elongation factor 1-alpha; (1 of 1) PTHR23115//PTHR23115:SF170 - TRANSLATION FACTOR // ELONGATION FACTOR 1-ALPHA 1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGGTGGGTTTTGGGTGGTGTACCTACCC |
| Internal bar code: | TAATTTGGACTTTAGGTTGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 70 |
| LEAP-Seq percent confirming: | 95.7447 |
| LEAP-Seq n confirming: | 90 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTGTCCGTGTTTCTGTCCT |
| Suggested primer 2: | GCCCACCTTGTACACGTTCT |