| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.226432 |
| Chromosome: | chromosome 5 |
| Location: | 3340924 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g240650 | DNJ32 | (1 of 1) K09506 - DnaJ homolog subfamily A member 5 (DNAJA5); DnaJ-like protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGTCATGGGTGCTGGGGTCAGGTGACGT |
| Internal bar code: | GGCTCAGAAATCGACGCGAAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 485 |
| LEAP-Seq percent confirming: | 91.1718 |
| LEAP-Seq n confirming: | 1136 |
| LEAP-Seq n nonconfirming: | 110 |
| LEAP-Seq n unique pos: | 46 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCACTCTCCAGCACATTCG |
| Suggested primer 2: | GAGGGAGGTGGCTACATCAA |