Insertion junction: LMJ.RY0402.226495_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.226495
Chromosome:chromosome_3
Location:4172654
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre03.g173750 sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):TGCCAACCGAGCTTGCGCGCTCGCTCCAGC
Internal bar code:CTTTAAATCCCATCTTTCCCGA

Confirmation - LEAP-Seq

LEAP-Seq distance:544
LEAP-Seq percent confirming:92.8767
LEAP-Seq n confirming:1356
LEAP-Seq n nonconfirming:104
LEAP-Seq n unique pos:32

Suggested primers for confirmation by PCR

Suggested primer 1:ATTAGCCAGGTTTTGCGATG
Suggested primer 2:GCTTTGAGCCTGTCCACTTC