| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.226513 |
| Chromosome: | chromosome 15 |
| Location: | 194730 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g635200 | BGY1 | BIGYIN-related tetratricopeptide protein; (1 of 1) PTHR13247:SF0 - MITOCHONDRIAL FISSION 1 PROTEIN | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATACAATCAAGGATTCACCTACACAAAAC |
| Internal bar code: | GAGGGTTTAACGTACGGGAACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 658 |
| LEAP-Seq percent confirming: | 96.7701 |
| LEAP-Seq n confirming: | 2277 |
| LEAP-Seq n nonconfirming: | 76 |
| LEAP-Seq n unique pos: | 66 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATGGGCTGTTCAAGCTCAC |
| Suggested primer 2: | GTGCACCGAGATGCACTAGA |