| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.226529 |
| Chromosome: | chromosome 3 |
| Location: | 5839472 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g189300 | PLAP10,PLP10 | (1 of 17) PF04755 - PAP_fibrillin (PAP_fibrillin); Plastid lipid associated protein 10 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTTGTAGTTGCTGACAGTGGACAGCGAGG |
| Internal bar code: | TTGCCTTGACTAGCCGCACTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 949 |
| LEAP-Seq percent confirming: | 99.6262 |
| LEAP-Seq n confirming: | 1066 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCACGTCACCGTCATCGTAT |
| Suggested primer 2: | CAGCACGCACCACATATACC |