Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.226715 |
Chromosome: | chromosome 9 |
Location: | 647606 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g403300 | (1 of 1) K03144 - transcription initiation factor TFIIH subunit 4 (TFIIH4, GTF2H4, TFB2) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGGCGTACCGTACTCGCAGCTACTGCCGG |
Internal bar code: | CCTTTGCCATAATAACATTTCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1186 |
LEAP-Seq percent confirming: | 98.6556 |
LEAP-Seq n confirming: | 1908 |
LEAP-Seq n nonconfirming: | 26 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGAAATTGCAGAACCAGTGC |
Suggested primer 2: | CTTCCTCTCCTCCTCCTCGT |