| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.226767 |
| Chromosome: | chromosome 16 |
| Location: | 6574096 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g672250 | MPA13 | Metallophosphoesterase/metallo-dependent phosphatase; (1 of 3) 3.1.3.26 - 4-phytase / Phytate 6-phosphatase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGCTGCGATGGGGCTGGTGGGCGGAAAGG |
| Internal bar code: | CGATCACTACTGCGTCCAATGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 206 |
| LEAP-Seq percent confirming: | 98.8764 |
| LEAP-Seq n confirming: | 88 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCCAACGGCCTTACCTACA |
| Suggested primer 2: | ACCTATTTCCAAGGCACACG |