| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.226866 |
| Chromosome: | chromosome 1 |
| Location: | 93544 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g000650 | AMX2 | (1 of 2) 1.4.3.21 - Primary-amine oxidase / Copper amine oxidase; Copper amine oxidase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGTGCGGTGTTGGGTGGTGGGTCGGGGT |
| Internal bar code: | AGCGACATAACACACCCCCACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 628 |
| LEAP-Seq percent confirming: | 96.7231 |
| LEAP-Seq n confirming: | 13135 |
| LEAP-Seq n nonconfirming: | 445 |
| LEAP-Seq n unique pos: | 128 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGCACAACCTCACCTACA |
| Suggested primer 2: | CATCTCTCCTCTTGGCGTTC |