Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.226870 |
Chromosome: | chromosome_16 |
Location: | 1440534 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Orientation | Feature |
---|---|---|---|---|
Cre16.g652400 | FAL18 | Similar to Flagellar Associated Protein FAP183 | antisense | intron |
Insertion site details | |
Flanking sequence (orientation from cassette outwards): | TTGGTCAATAGCGGGCGTTGATGGAACGAT |
Internal bar code: | GCGTGGCCGCGGAATGGACGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 633 |
LEAP-Seq percent confirming: | 99.4048 |
LEAP-Seq n confirming: | 668 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGGTAGGCTGTGTGTGAGGC |
Suggested primer 2: | GGGTTGAAAGGCTGTTGGTA |