| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.226874 |
| Chromosome: | chromosome 16 |
| Location: | 111962 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g695450 | SPL11,UAF4 | U2 snRNP auxiliary factor, large subunit; (1 of 1) PTHR23139:SF68 - ZINC FINGER CCHC-TYPE AND RNA-BINDING MOTIF-CONTAINING PROTEIN 1 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTATTACCAGTAGCTAGCTGCGGTTGTTGG |
| Internal bar code: | CCTGCATTAGCGTCCGCCATAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 384 |
| LEAP-Seq percent confirming: | 99.5429 |
| LEAP-Seq n confirming: | 2613 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACAGGAATCGCGCCTACTC |
| Suggested primer 2: | GCTACTGTCACGTCACGCAT |