| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.226928 |
| Chromosome: | chromosome 3 |
| Location: | 6511350 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g195200 | HLD1,CGL76 | Conserved in the Green Lineage; (1 of 6) IPR000073//IPR000639//IPR029058 - Alpha/beta hydrolase fold-1 // Epoxide hydrolase-like // Alpha/Beta hydrolase fold | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTTGATTCGAGCAACCCCCAAGCCCAAGC |
| Internal bar code: | GGCGCTATCGAGGCAGTTGTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 616 |
| LEAP-Seq percent confirming: | 98.9684 |
| LEAP-Seq n confirming: | 2878 |
| LEAP-Seq n nonconfirming: | 30 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTACTGGCTCAGGACGAAGC |
| Suggested primer 2: | CTATTAGCAAGCTGGCTCCG |