| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.226935 |
| Chromosome: | chromosome 7 |
| Location: | 2151827 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g326600 | PDI6 | (1 of 4) K09584 - protein disulfide-isomerase A6 (PDIA6, TXNDC7); Protein disulfide isomerase 6 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCCATCGGCAGGGAAGCGGTGGGGAGGGG |
| Internal bar code: | GATGCCTATGGACATTGACGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 344 |
| LEAP-Seq percent confirming: | 99.2687 |
| LEAP-Seq n confirming: | 1086 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTGTGAAGAGCAACTTCCG |
| Suggested primer 2: | CTGCCTTACCACTGTCCCAT |