| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.226974 |
| Chromosome: | chromosome 1 |
| Location: | 4291430 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g028850 | (1 of 25) PF00581 - Rhodanese-like domain (Rhodanese) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCTAGGACCGTATCCGGTACATGTCAGTA |
| Internal bar code: | ATCGGTGGCTACGCCTGATGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 494 |
| LEAP-Seq percent confirming: | 98.7907 |
| LEAP-Seq n confirming: | 3758 |
| LEAP-Seq n nonconfirming: | 46 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGATGTGATGTCGTGCGTT |
| Suggested primer 2: | CTTCCGACTTTGCCAGTCTC |