Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.227037 |
Chromosome: | chromosome 4 |
Location: | 1309577 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g214650 | BGS5,GSL1,GTR19 | Glucan synthase-like 1; (1 of 7) 2.4.1.34 - 1,3-beta-glucan synthase / UDP-glucose-1,3-beta-D-glucan glucosyltransferase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACGAGCTGTGAAGAAGCAAGGGCCCGGCG |
Internal bar code: | ACTGAGCACGGTTAAAAGCTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 195 |
LEAP-Seq percent confirming: | 18.3516 |
LEAP-Seq n confirming: | 167 |
LEAP-Seq n nonconfirming: | 743 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGCAGTAGCAGCAGTAGCG |
Suggested primer 2: | GTCAAACGTTCAGGGCAAGT |