Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.227121 |
Chromosome: | chromosome 11 |
Location: | 1794767 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g467500 | (1 of 1) PF05664 - Plant family of unknown function (DUF810) (DUF810) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGGCATTTCCTTTGGCCTCCTCGCCCCCT |
Internal bar code: | TGGAACGTGTACTACGGCTCGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 563 |
LEAP-Seq percent confirming: | 94.9123 |
LEAP-Seq n confirming: | 4384 |
LEAP-Seq n nonconfirming: | 235 |
LEAP-Seq n unique pos: | 80 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GATCACCCCTTGTGACGAGT |
Suggested primer 2: | GTACCGTATCCCCCACACAC |