| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.227160 |
| Chromosome: | chromosome 16 |
| Location: | 7400693 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g685613 | (1 of 1) PF02689//PF05970 - Helicase (Herpes_Helicase) // PIF1-like helicase (PIF1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGATGCCCCGACGCCCGTGCCTCAGGCC |
| Internal bar code: | AAGGCTACGGGCAACGGCTCCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 864 |
| LEAP-Seq percent confirming: | 98.3155 |
| LEAP-Seq n confirming: | 1284 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGCTGTGGTGGTAAATGGC |
| Suggested primer 2: | GAGGCAGAAACAGTGGAAGC |