| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.227344 |
| Chromosome: | chromosome 6 |
| Location: | 7945646 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g303483 | (1 of 5) IPR001005//IPR009057//IPR017877 - SANT/Myb domain // Homeodomain-like // Myb-like domain | CDS/intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCTACCGAACTCGGCGTGCAGCCGTGCA |
| Internal bar code: | CTCGGATGCCGCGACTGTCCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 625 |
| LEAP-Seq percent confirming: | 98.9837 |
| LEAP-Seq n confirming: | 1948 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATACCTTGAAACAATGCGGC |
| Suggested primer 2: | AATTGCAACAAGACGCTGTG |