Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.227644 |
Chromosome: | chromosome 10 |
Location: | 5111931 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g456250 | TRX16,TRX25,TRL11 | (1 of 4) PTHR10438//PTHR10438:SF255 - THIOREDOXIN // THIOREDOXIN M4, CHLOROPLASTIC; Thioredoxin-like protein | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAACGTAGCACGACGCCACCAAGGGCTGC |
Internal bar code: | CTTCGGGTACGGGGGTAGAATC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1192 |
LEAP-Seq percent confirming: | 99.3952 |
LEAP-Seq n confirming: | 3944 |
LEAP-Seq n nonconfirming: | 24 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTCGGTTGTTTGTTGCATTG |
Suggested primer 2: | GTGTGACATGTGCAAAAGGG |