| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.227660 |
| Chromosome: | chromosome 13 |
| Location: | 1381237 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g571850 | APC10 | Anaphase promoting complex subunit 10; (1 of 1) K03357 - anaphase-promoting complex subunit 10 (APC10, DOC1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTGGCAGACCCAGACGCCCCGCATACGTC |
| Internal bar code: | TTGCGCCTTCGTAAACAATCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 719 |
| LEAP-Seq percent confirming: | 99.3039 |
| LEAP-Seq n confirming: | 4565 |
| LEAP-Seq n nonconfirming: | 32 |
| LEAP-Seq n unique pos: | 46 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGAAGCACGTAGCAAGGAA |
| Suggested primer 2: | TCATGGTCAAGGCTTGTCAG |