| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.227661 |
| Chromosome: | chromosome 12 |
| Location: | 3530351 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g513254 | (1 of 2) K15340 - DNA cross-link repair 1A protein (DCLRE1A, SNM1A, PSO2) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCACGATAGACGACGAAACGGATGAGGAT |
| Internal bar code: | CTCCCCCGAGTGGGGATTTGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 720 |
| LEAP-Seq percent confirming: | 98.3107 |
| LEAP-Seq n confirming: | 2386 |
| LEAP-Seq n nonconfirming: | 41 |
| LEAP-Seq n unique pos: | 66 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGTTGTGGAAACGGACTTG |
| Suggested primer 2: | ATTGCATGGTCTTGTAGGGC |